基因组步移法

A specific and versatile genome walking technique

Haitao Guo,Jin Xiong ?

Department of Biology,Texas A and M University,College Station,TX 77843,USA Received 2March 2006;received in revised form 2June 2006;accepted 15June 2006

Available online 21June 2006Received by A.Bernardi

Abstract

We describe here a nested PCR-based strategy for genome walking to extend a known sequence region to its uncharacterized flanking regions.This technique involves the use of a partially degenerate primer as a walker primer and a set of nested specific primers to perform two to three successive rounds of nested PCR.To increase the success rate of genome walking,four different walker primers were designed to allow the setup of parallel reactions.This technique was applied to amplify flanking sequences of known genomic loci of two highly divergent photosynthetic organisms,Rhodobacter capsulatus and Heliophilum fasciatum .Specific products were preferentially amplified using this strategy,which were verified using DNA sequencing.The extremely high success rate of extension of genomic regions in these two organisms suggests that this technique can be applied to a wide range of genomes.?2006Elsevier B.V .All rights reserved.

Keywords:Heliophilum fasciatum ;Nested PCR;Partial degenerate primers;Rhodobacter capsulatus ;Touchdown PCR

1.Introduction

Genome walking is a basic molecular biology technique.It involves a stepwise determination of uncharacterized DNA sequence flanking a known sequence region.This technique has many applications such as closing genome sequence gaps in the finishing phase of whole genome sequencing (Carraro et al.,2003;Rogers et al.,2005)and identification of insertion sites of transposons in gene disruption analysis (Huang et al.,2000;Levano-Garcia et al.,2005).

A number of PCR-based methods have been developed to define flanking sequences from known genomic loci.The methods essentially fall into two categories:preprocessing-dependent and preprocessing-independent.The first category requires restriction digestion and ligation of genomic DNA,which includes inverse PCR (Ochman et al.,1988;Triglia et al.,1988),ligation-mediated PCR (Pfeifer et al.,1989),vectorette PCR (Arnold and Hodgson,1991),and panhandle PCR (Jones and Winistorfer,1993).The procedures rely on successful DNA self circularization or ligation to specifically designed adaptors.

Their main limitations are the requirement of a large amount of starting material (2–10μg of DNA)and the dependence of the availability of restriction sites.

The second category is nearly entirely PCR-based and does not require restriction and ligation.These methods include universal fast walking (Myrick and Gelbart,2002),targeted gene-walking (Parker et al.,1991),and interlaced PCR (Liu and Whittier,1995).These methods rely on the binding of degenerate primers near the ends of a known sequence,which is amplified by PCR with specific primers from the known region.They have been shown to be effective under certain circumstances.Though no preproces-sing is needed,some methods in this category still require a significant level of sample handling during or after the amplification,such as purification of biotinylated intermediate products and exonuclease treatment.In many cases,high rates of non-specific PCR products are encountered.

Recently,Levano-Garcia et al.(2005)reported using a touchdown PCR protocol to amplify gene flanking regions with the use of partially degenerate primers (hybrid consensus degenerate primers)and a single specific primer.This method,belonging to the second category,requires simple manipulations and only a limited amount of starting DNA.The authors showed an example of using this strategy by mapping transposon insertion sites of Xanthomonas citri .This technique,however,based on

our

Gene 381(2006)18–

23

https://www.360docs.net/doc/832103611.html,/locate/gene

Abbreviations:nt,nucleotide;Tm,melting temperatures of oligonucleotides.?Corresponding author.Tel.:+9794583462;fax:+9798452891.E-mail address:jxiong@https://www.360docs.net/doc/832103611.html, (J.Xiong).

0378-1119/$-see front matter ?2006Elsevier B.V .All rights reserved.doi:10.1016/j.gene.2006.06.002

experience,also suffers from high rates of non-specific PCR products caused by the partial degenerate primers.

To suppress the PCR artifacts and allow specific genome walking for a wide range of genomes,we developed an improved method that employs a nested PCR with a set of nested specific primers and a partially degenerate primer.By performing two to three successive rounds of nested PCR,we successfully amplified unknown sequence regions flanking known sequence regions in the genomes of two highly divergent photosynthetic bacteria,Rhodobacter capsulatus and Heliophi-lum fasciatum .Our improved method is shown to be specific and consistent in allowing high success rates even for difficult genomic templates.2.Materials and methods

2.1.Bacterial culture and genomic DNA isolation

In this study,two photosynthetic bacteria were used,R.capsulatus and H.fasciatum .For R.capsulatus ,both the wild type and an engineered strain JX47were used.The strain JX47was initially created for studying circadian oscillations of gene expression using a luciferase reporter.Its genomic DNA contained an engineered Tn5transposon carrying a pair of luciferase reporter genes (luxA and luxB )on the one end and a transposase (Tnase)gene on the other end.The engineered transposon was introduced to R.capsulatus through a triparental mating procedure described in Min et al.(2005).

The R.capsulatus strains were grown in a 100-ml RCV 2/3PY (Young et al.,1989)liquid medium at 34°C with vigorous shaking (250rpm)for overnight.The cells were harvested by

centrifugation at 5000g for 10min and were subsequently used for genomic DNA isolation.The genomic DNA isolation was according to Pospiech and Neumann (1995).Briefly,the cells were lysed with lysozyme.The cellular extract was treated with 10%SDS and proteinase K (Sigma-Aldrich).The DNA was separated from the proteinaceous part using chloroform.The genomic DNA was subsequently precipitated with isopropanol and washed with ethanol.

Wild type H.fasciatum was purchased from ATCC (Manassas,V A)and was found to be nonviable.The lyophilized bacterial stock was used directly for DNA isolation according to Pospiech and Neumann (1995).2.2.PCR primers

Oligonucleotide primers used in the PCR included specific primers for a particular genomic locus and walker primers containing degenerate nucleotides (nt)mixed with specific ones.Four walker primers with partial degeneracy were designed:semi-1,semi-2,semi-3and semi-4,with semi-1nearly identical to the HIB17primer in Levano-Garcia et al.(2005).Primers semi-2,semi-3and semi-4were either reverse complement of semi-1at various local regions or slight modifications of it.Each of the walker primers was 25nt long with 13non-degenerate nt on the 5′end,2non-degenerate nt on the 3′end,and with 6degenerate nt intermixed with 4specific nt in between the two ends (Table 1).

The locus-specific primers were 17–26nt in length and were exact matches to a known sequence region from either of the two genomes (see Table 1).Each set of specific primers (Table 1)was nested and pointing outwardly from a known sequence end.All

Table 1

Primers used in this work,their sequences,target gene loci and direction of extension Primer name Sequence

Gene locus/direction/organism Specific primers LuxA-1CAGTAATACTTGTAACGTCCTCAAATC luxA /upstream/R.capsulatus LuxA-2CATGTGAACTTCCAATTAGCGAATAG luxA /upstream/R.capsulatus Tnase-1CAGTACGGCGTGGATCAC

Tnase /downstream/R.capsulatus Tnase-2GAGAACACAGATTTAGCCCAGTC Tnase /downstream/R.capsulatus ATPdn-1CGACATGGCCTATCCGATCATCC ATPase /downstream/R.capsulatus ATPdn-2CAGGTCAAGCAGATCCTCGACG ATPase /downstream/R.capsulatus ATPup-1GAAGAGATCGCCGTCCTCG

ATPase /upstream/R.capsulatus ATPup-2GAGGTTCATGAAGAAGGTCTCGAGG ATPase /upstream/R.capsulatus HemL-1GGGTAAGTAATATAGTCAAGCAATAGAG hemL /downstream/H.fasciatum HemL-2GGATCACAAAAGAACGGAGGAGTAC hemL /downstream/H.fasciatum Hep2-1CCCGGCGTGTTTCTGATTCG hep2/upstream/H.fasciatum Hep2-2CATGAACCAAGGTGGCCATG

hep2/upstream/H.fasciatum Tatc-1AACCCAAAGTAAATGAGACAGTCC tatC /upstream/H.fasciatum Tatc-2GTTTCTACACTATGCACGATCTTCC tatC /upstream/H.fasciatum Tatc-3CTCATACAACAAATACATCGGCAAGG tatC /upstream/H.fasciatum ppx-1TGCCACCCCGTCTGGGTC ppx /upstream/H.fasciatum ppx-2ATGCCAGCGTCCGGCAGG ppx /upstream/H.fasciatum ppx-3

CCACTTCAGCACTGCCGCC

ppx /upstream/H.fasciatum

Semi-degenerate primers Semi-1GCCAATTCCGGATNGAYKSNGGNTC Universal walker primer Semi-2GCCTTAAGGCCTANGARMSNCCNAG Universal walker primer Semi-3CGGTTAAGGCCTANYTCSKNGANGC Universal walker primer Semi-4

GCCAATTCCGGATNSAGYMNCTNCG Universal walker primer

19

H.Guo,J.Xiong /Gene 381(2006)18–23

primers were synthesized by Integrated DNA Technologies (Coralville,IA).The Tms of the specific primers ranged from 54°C to 61°C based on the manufacturer's estimations.2.3.PCR conditions

The PCR amplification was carried out in a volume of 100μl containing 1μM of each of the two primers,250μM dNTPs and 1X reaction buffer (8%glycerol,5.5%DMSO,30mM tricine,pH 8.4,2mM MgCl 2,5mM β-mercaptoethanol,16mM (NH 4)2SO 4,0.05%NP-40).Approximately 20ng of genomic DNA were used in the initial round of PCR.The PCR was “hot-started ”in a thermal cycler (PTC-100,MJ Research,Watertown,MA)by adding 2μl Pfu DNA polymerases (～10U)after 5min incubation of DNA at 96°C.The subsequent thermal cycling routine was essentially based on one of the touchdown protocols (protocol 2)by Levano-Garcia et al.(2005).Briefly,in the phase 1,DNA was denatured at 95°C for 45s and was subsequently annealed at a temperature from 60°C to 47.5°C for 45s with a stepwise decreasing gradient of 0.5°C/cycle.Elongation was carried out at 72°C for 2min in each cycle.In the phase 2,35cycles of 3-step PCR were carried out with each cycle consisting of 95°C denaturation for 45s,50°C annealing for 45s,and 72°C elongation for 2min.

For re-amplification using a hemi-nested design,1μl of the undiluted product from the first round of PCR was used as template for the second round of PCR containing 1μM of an inner nested specific primer and 1μM of the same partially degenerate walker primer.To use a fully nested design,a different degenerate primer was used in addition to a different specific primer.The third round of nested PCR was similarly carried out using 1μl of

the second round reaction product as template and a primer pair consisting of a further nested specific primer and a walker primer.2.4.Gel analysis and DNA sequencing

Ten microliters of the PCR products were used in electropho-resis in a 1%agarose gel in a TBE buffer stained with ethidium bromide.The DNA was visualized under a UV light.When necessary,the bands of interest were excised from the gel and purified with the Qiaquick Gel Extraction Kit (Qiagen,Valencia,CA)according to the manufacturer's instructions.DNA sequenc-ing was performed with a fluorescent dye-labeled dideoxynucleo-tide sequencing reaction kit (BigDye Terminator Sequencing Kit,Applied Biosystems,Foster City,CA).Only specific primers were used in the sequencing reactions.3.Results and discussion

3.1.Principle of the current technique

In this study,we developed a modified genome walking technique based on nested PCR whose principle is illustrated in Fig.1.The procedure involves the use of the product from the first round of PCR to serve as template for the second round PCR whose product in turn serves as template for the third round PCR.The reaction is carried out through a hemi-nested design with a set of three nested locus-specific primers and a common partially degenerate primer (walker primer)for use in successive rounds of PCR.Four universal walker primers were designed.To test which walker primer can produce the best result,four series of reactions can be carried out in parallel (Table 1

).

Fig.1.Schematic of the nested PCR-based genome walking technique using a hemi-nested design that suppresses potential PCR artifacts.The procedure involves three (sometimes two)rounds of PCR with one partially degenerate walker primer (W1)and a set of nested specific primers (Sp1,Sp2and Sp3)matching a known sequence region.Specific products can be preferentially amplified using this strategy.Any potential undesired PCR products are essentially eliminated after the second and/or third round of reactions.Known sequence regions are represented by shaded areas;unknown sequence regions by dashed lines.In the case of artifactual amplification,dashed lines represent non-target genomic loci.Straight arrows represent specific primers;wavy arrows represent non-specific primers that partially hybridize to genomic loci.Vertical thin lines above the primers indicate oligonucleotide complementarity to the genomic DNA.High density vertical thin lines represent specific priming with complete complementarity;and sparse density represents partial complementarity by non-specific priming.In the later cycles of a PCR reaction,primer sequences from either specific or non-specific primers are included to produce full complementarity.

20H.Guo,J.Xiong /Gene 381(2006)18–23

The main problem encountered using degenerate primers in PCR-based genome walking is the non-specific amplification of PCR products.One of the potential problems in the strategy employed by Levano-Garcia et al.(2005)is the artifactual amplification initiated either by the hybridization to a non-target locus by the degenerate primer alone or by the mispriming of both the specific primer and the walker primer on a non-target locus in the genomic DNA(Fig.1).

To reduce false positive products,nested PCR can be employed(see review,Sachse,2003).The successive PCR rounds using different specific primers can significantly reduce the non-specific amplification because the spurious PCR products are unlikely to contain binding sites for the inner specific primers. Though the presence of the same walker primer in theory can continue to amplify the non-specific products in the successive rounds,in our experience,reamplification of the same PCR products using the same primer pair is rarely successful,partially due to the poor primer binding efficiencies at the sequence ends. In addition,genomic DNA used in the first round of PCR was diluted by100fold in the second PCR round and reached an ineffective concentration(～0.2ng/100μl)for it to serve as template for possible artifacts.The lowering of the effective concentration of genomic DNA may also include template degradation such as depurination that may have resulted from the previous thermal cycles(Lindahl,1993).Another potential artifact in the initial step may result from the partial hybridization of a specific primer in an undesired locus.This can be eliminated in the second round of PCR using an inner nested specific primer.

To verify the specificity of the amplification products,a re-PCR using an original locus-specific primer and a gene-specific primer based on the newly generated sequence can be performed to verify whether the band produced by the specific primer pair match that by the locus-specific and walker primers.However, this approach has an inherent problem of not being able to completely eliminate the possible artifactual products because the artifacts may be of the expected size by chance.More conclusive verification requires DNA sequencing of the products using the locus-specific primers as suggested by Levano-Garcia et al. (2005).If the initial region of the new sequence completely overlaps the end region of the previously known sequence,this constitutes good evidence of correct amplification because it is extremely unlikely for any artifactual PCR products to contain the same sequence.

A key to the success of this strategy is the bipartite structure of the walker primers with degenerate bases positioned close to the 3′end and non-degenerate bases on the5′end.Levano-Garcia et al.(2005)designed the“hybrid”primers based on the protein encoding regions of Schistosoma mansoni mRNAs and applied the primers in determining transposon insertion sites in X.citri. Regier and Shi(2005)have shown that by adding a5′tail of non-degenerate,non-homologous sequence to the degenerate3′end of PCR primers,the stability of the primers can be greatly increased, which led to increased yields of PCR products.The increase in efficacy of the primers was thought to be due to the increase

of Fig.2.Nested PCR results with the use of specific primers and universal walker

primers for amplification of various loci of R.capsulatus and H.fasciatum genomic

DNA.Upstream genome walking is indicated by↑whereas downstream walking by

↓.All PCR products(10μl out of100μl reactions)were electrophoresed in1%

agarose gels(110V,50min)stained with ethidium bromide.M,100bp DNA ladder

(New England Biolabs)https://www.360docs.net/doc/832103611.html,nes1–4:detection of transposon insertion sites in the

genomic DNA of the JX47strain of R.capsulatus.Specific products were generated

after two rounds of hemi-nested https://www.360docs.net/doc/832103611.html,ne1,first step nested PCR amplification for

the upstream region of the transposon luxA gene using primers luxA-1and semi-2.

Lane2,second step nested PCR amplification for the upstream region of the

transposon luxA gene using primers luxA-2and semi-2(final product500bp).Lane

3,first step nested PCR amplification for the downstream region of the transposase

Tnase gene using primers Tnase-1and https://www.360docs.net/doc/832103611.html,ne4,second step nested PCR

amplification for the downstream region of the transposase Tnase gene using primers

Tnase-2and semi-1(final product600bp).Lanes5–8:walking upstream and

downstream from the transposon insertion site in the wild type R.capsulatus

genomic DNA.Specific products were generated after two rounds of hemi-nested

https://www.360docs.net/doc/832103611.html,ne5,first step nested PCR amplification for the upstream region of the

A TPase gene using primers A TPup-1and https://www.360docs.net/doc/832103611.html,ne6,second step nested PCR for

amplification of the upstream region of the A TPase gene using primers A TPup-2and

semi-2(final product800bp).Lane7,first step nested PCR amplification for the

downstream region of the A TPase gene using primers A TPdn-1and https://www.360docs.net/doc/832103611.html,ne8,

second step nested PCR amplification for the downstream region of the A TPase gene

using primers A TPdn-2and semi-3(final product500bp).B.Nested PCR

amplification on flanking regions of various loci of the H.fasciatum genomic DNA.

Lanes1–4,specific products generated after two rounds of hemi-nested PCR.M,

100bp DNA https://www.360docs.net/doc/832103611.html,ne1,first step nested PCR amplification for the downstream

region of the hemL gene using primers HemL-1and https://www.360docs.net/doc/832103611.html,ne2,second step

nested PCR amplification for the downstream region of the hemL gene using primers

HemL-2and semi-3(final product550bp).Lane3,first step nested PCR

amplification for the upstream region of the hep2gene using primers Hep2-1and

https://www.360docs.net/doc/832103611.html,ne4,second step nested PCR amplification for the upstream region of the

hep2gene using primers Hep2-2and semi-3(final product800bp).Lanes5–10,

specific products generated after three rounds of hemi-nested https://www.360docs.net/doc/832103611.html,ne5,first step

nested PCR amplification for the upstream region of the tatC gene using primers

Tatc-1and https://www.360docs.net/doc/832103611.html,ne6,second step nested PCR amplification for the upstream

region of the tatC gene using primers Tatc-2and https://www.360docs.net/doc/832103611.html,ne7,third step nested

PCR amplification for the upstream region of the hep2gene using primers Tatc-3and

semi-3(final product900bp).Lane8,first step nested PCR amplification for the

upstream region of the ppx gene using primers ppx-1and https://www.360docs.net/doc/832103611.html,ne9,second step

nested PCR amplification for the upstream region of the ppx gene using primers ppx-

2and https://www.360docs.net/doc/832103611.html,ne10,third step nested PCR amplification for the upstream region of

the ppx gene using primers ppx-3and semi-2(final product650bp).

21 H.Guo,J.Xiong/Gene381(2006)18–23

overall Tm of the primers in subsequent PCR cycles following the initial PCR cycle.In this study,we designed partial degenerate primers and used them successfully in genome walking in two different photosynthetic bacteria.The results confirmed that the actual sequences on the5′end of the walker primers were not important but that their presence served to enhance the effectiveness of the overall degenerate primer.

In addition to the hemi-nested design,a fully nested design which involved the pairing of completely different walker primers and specific primers in each round of nested PCR was also tested and shown to perform equally well as the hemi-nested design (data not shown).The fully nested design may further increase the specificity of the PCR results and can be used as an alternative to the hemi-nested design,which increases the versatility of the available primer pairs.

Based on the design in Fig.1,it is possible to apply a multiplex PCR design by which more than one pair of specific primer and walker primer are added in a single reaction.Though the idea is to allow fewer reactions to be set up,the multiplexed design poses new risks of increasing spurious amplification products due to the presence of multiple primers.

3.2.Applications of the new genome walking technique

We first applied the newly developed genome walking technique to map the Tn5transposon insertion site in the R. capsulatus JX47strain.As shown in Fig.2A(lanes1–4), specific amplification of the upstream region of luxA(the first gene in the transposon)and the downstream region of the Tnase gene(the last gene in the transposon)was achieved after two rounds of nested PCR.The products were sequenced and verified to originate in a region completely overlapping with that in the known sequence end(50–150bp in length).The newly determined sequences also contained information of the transposon insertion site.Through database homology search-ing of the sequences,the insertion site was found to be in the middle of a gene encoding a PP-family ATPase.Additional walking steps were taken to amplify a near full length sequence of the ATPase gene(Fig.2A,lanes5–8)using wild type R. capsulatus genomic DNA as starting template.

We further applied the genome walking technique to obtain flanking sequences for a number of partially sequenced genes previously obtained in H.fasciatum genomic DNA(A. Pancholy and J.Xiong,unpublished data).These include partial sequences of the hemL,hep2,tatC and ppx genes,which were located at the ends of large genomic fragments obtained previously.For these genomic loci,only unidirectional walking was performed.After two rounds sometimes three rounds of hemi-nested PCR,flanking sequences to those genes with sizes ranging from0.5to0.9kb were obtained(Fig.2B).DNA sequence analysis of the newly obtained sequences showed that the downstream sequence of hemL encodes a conserved hypothetical protein and that the upstream sequence of hep2 encodes an RNA ligase.The upstream sequence of tatC was found to be still within its own reading frame,whereas the sequence upstream of the ppx region only contains intergenic sequences.The newly obtained sequences from these two organisms have been submitted to GenBank(accession numbers,DQ823379,DQ665833,DQ665834,DQ665835, and DQ665836).Detailed bioinformatics analysis of these sequence regions will be published elsewhere.

It is noticeable that sometimes multiple prominent products could be obtained in the intermediate steps of nested PCR(e.g. lane6in Fig.2B).This is thought to be due to potential multiple binding sites by the walker primer close to the end of a known sequence region.However,the presence of multiple weak and indistinct bands is often an indication of artifacts(lane3in Fig. 2A;lanes8and9in Fig.2B).It is also noticeable that specific amplification could rarely be obtained in the first round of PCR, which justified the need for improvement of the original method developed by Levano-Garcia et al.(2005).

Another non-trivial factor that may have contributed to the success of our genome walking is the unique PCR buffer that contains additives of glycerol and DMSO,both of which have been shown to enhance the specificity and overall effectiveness of PCR(Pomp and Medrano,1991).

In conclusion,we achieved an extremely high rate of success in genome walking mainly through hemi-nested PCR with the aid of a partially degenerate walker primer.We were able to amplify and extend all the genomic loci that we had attempted.The technique is robust regardless of the GC content of the genome judging from the wide gap of the GC content between R. capsulatus(68%,Haselkorn et al.,2001)and H.fasciatum(52%, A.Pancholy and J.Xiong,unpublished data).The two bacteria were phylogenetically very divergent with R.capsulatus being a GC-rich gram-negative proteobacterium and H.fasciatum a GC-even gram-positive firmicute.The successful application of this technique in two such divergent genomes suggests that it can be used in a wide range of genomes.

Compared to other existing PCR-based genome walking techniques,the main feature of our newly developed method is high specificity exemplified by one single prominent final product resulted from nested PCR.In addition,the method performs direct genome walking without the need for restriction digestion and ligation and with only minimal sample handling required.The method can effectively amplify genomic regions regardless of the template complexity.The availability of four universal walker primers allows the setup of at least four parallel hemi-nested reactions and many more full-nested reactions, which greatly increases the versatility of this technique.The requirement of a small amount of starting genomic DNA(20ng) confers another advantage in situations when the amount of starting DNA is a limiting factor such as DNA extracted from environmental samples or non-culturable prokaryotic organisms.

Acknowledgements

We thank Carl Bauer for providing the wild type Rhodobacter capsulatus strain and Hongtao Min for constructing the JX47 strain.Randall Gil and Kelly Zhao provided technical assistance during the early stage of the technique development.We thank Sarah Fremgen for critical reading of the manuscript.JX thanks the Welch Foundation for support(grant no.A1589).

22H.Guo,J.Xiong/Gene381(2006)18–23

References

Arnold,C.,Hodgson,I.J.,1991.Vectorette PCR:a novel approach to genomic walking.PCR Methods Appl.1,29–42.

Carraro,D.M.,et al.,2003.PCR-assisted contig extension:stepwise strategy for bacterial genome closure.Biotechniques34,626–632.

Haselkorn,R.,et al.,2001.The Rhodobacter capsulatus genome.Photosynth.

Res.70,43–52.

Huang,G.,Zhang,L.,Birch,R.G.,2000.Rapid amplification and cloning of Tn5flanking fragments by inverse PCR.Lett.Appl.Microbiol.31, 149–153.

Jones,D.H.,Winistorfer,S.C.,1993.Genome walking with2-to4-kb steps using panhandle PCR.PCR Methods Appl.2,197–203.

Levano-Garcia,J.,Verjovski-Almeida,S.,da Silva,A.C.R.,2005.Mapping transposon insertion sites by touchdown PCR and hybrid degenerate primers.Biotechniques38,225–229.

Lindahl,T.,1993.Instability and decay of the primary structure of DNA.Nature 362,709–715.

Liu,Y.-G.,Whittier,R.F.,1995.Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking.Genomics25,674–681. Min,H.,Guo,H.,Xiong,J.,2005.Rhythmic gene expression in a purple photosynthetic bacterium,Rhodobacter sphaeroides.FEBS Lett.579, 808–812.

Myrick,K.V.,Gelbart,W.M.,2002.Universal fast walking for direct and versatile determination of flanking sequence.Gene284,125–131.Ochman,H.,GeRer,A.S.,Hartl,D.L.,1988.Genetic applications of an inverse polymerase chain reaction.Genetics120,621–623.

Parker,J.D.,Rabinovitch,P.S.,Burmer,G.C.,1991.Targeted gene walking polymerase chain reaction.Nucleic Acids Res.19,3055–3060. Pfeifer,G.P.,Steigerwald,S.D.,Mueller,P.R.,Wold,B.,Riggs,A.D.,1989.

Genomic sequencing and methylation analysis by ligation mediated PCR.

Science246,810–813.

Pomp,D.,Medrano,J.F.,https://www.360docs.net/doc/832103611.html,anic solvents as facilitators of polymerase chain reaction.Biotechniques10,58–59.

Pospiech,A.,Neumann,B.,1995.A versatile quick-prep of genomic DNA from gram-positive bacteria.Trends Genet.11,217–218.

Regier,J.C.,Shi,D.,2005.Increase yield of PCR product from degenerate primers with nondegenerate,nonhomologous5′tails.Biotechniques38,34–38. Rogers,Y.C.,Munk,A.C.,Meincke,L.J.,Han,C.S.,2005.Closing bacterial genomic sequence gaps with adaptor-PCR.Biotechniques39,31–34. Sachse,K.,2003.Specificity and performance of diagnostic PCR assays.

Methods Mol.Biol.216,3–29.

Triglia,T.,Peterson,M.G.,Kemp, D.J.,1988.A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequence.Nucleic Acids Res.16,8186.

Young,D.A.,Bauer,C.E.,Williams,J.C.,Marrs,B.L.,1989.Genetic evidence for superoperonal organization of genes for photosynthetic pigments and pigment-binding proteins in Rhodobacter capsulatus.Mol.Gen.Genet.218, 1–12.

23

H.Guo,J.Xiong/Gene381(2006)18–23