差异基因 GO分析

Analysis of differentially expressed genes in placental tissues of preeclampsia patients using microarray combined with

the Connectivity Map database

Y.Song a,J.Liu a,*,S.Huang a,L.Zhang b

a Department of Obstetrics&Gynecology,Peking Union Medical College Hospital,Chinese Academy of Medical Science,Peking Union Medical College, Beijing,PR China

b BioChain(Beijing)Science&Technology Inc.,No.7A,Yongchang North Rd,Business Development Area,Beijing,PR China

a r t i c l e i n f o

Article history:

Accepted19September2013

Keywords:

Preeclampsia

Microarray

Expression pro?les Connectivity Map database a b s t r a c t

Preeclampsia(PE),which affects2e7%of human pregnancies,causes signi?cant maternal and neonatal morbidity and mortality.To better understand the pathophysiology of PE,the gene expression pro?les of placental tissue from5controls and5PE patients were assessed using microarray.A total of224tran-scripts were signi?cantly differentially expressed(>2-fold change and q value<0.05,SAM software). Gene Ontology(GO)enrichment analysis indicated that genes involved in hypoxia and oxidative and reductive processes were signi?cantly changed.Three differentially expressed genes(DEGs)involved in these biological processes were further veri?ed by quantitative real-time PCR.Finally,the potential therapeutic agents for PE were explored via the Connectivity Map database.In conclusion,the data obtained in this study might provide clues to better understand the pathophysiology of PE and to identify potential therapeutic agents for PE patients.

ó2013Elsevier Ltd.All rights reserved.

1.Introduction

One of the leading causes of mortality and morbidity amongst pregnant women and their offspring is PE,which affects2e7%of all pregnancies,depending on the diagnostic criteria and the patients’ethnicity[1].PE is generally de?ned as new hyperten-sion and substantial proteinuria at or after20weeks gestation.It is generally accepted that PE involves two pathophysiological stages.The?rst stage occurs when impaired trophoblasts invade the myometrial arteries,leading to reduced uteroplacental arte-rial?ow and episodes of irregular placental perfusion,followed by ischemic hypoxia and oxidative stress.The second stage of PE is thought to be the maternal response to abnormal placentation. An intrinsic failure in trophoblast differentiation at different time points of ontogeny may lead to either a mild disorder with late-onset appearance or to intrauterine growth retardation,poten-tially complicated with maternal symptoms[2].Systemic endothelial dysfunction appears to be an important common factor[3,4].

Despite breakthroughs in the understanding of the patho-genesis of PE,the mechanisms that ultimately trigger the disease are still not clearly elucidated[5].It seems clear that the development of PE requires the placenta,given that PE can occur in molar pregnancies wherein a placenta,but no fetus,is present.Furthermore,the only effective treatment of PE is de-livery of the placenta[6,7].Previous studies also showed that PE has a strong familial predisposition,and it has been concluded that a hereditary element may exist.Therefore,it is clinically useful to compare the gene expression pro?les of placentas with and without PE to better understand the pathophysiology of this disease and to aid in the development of new therapies [8,9].

Microarray technology is a powerful tool for simultaneously assessing the expression of a high number of genes and to pinpoint the patterns of gene expression associated with a disease[10].To date,a number of microarray studies have been conducted on the global gene expression pro?les of the PE placenta,and several important genes have been identi?ed using this strategy[11e18]. However,a comparison of different studies performed using DNA microarrays has shown poor overlap,and therefore,only a minority of DEGs are shared between these studies.The resulting differences may be due to the diverse genetic backgrounds of the study pop-ulation,the use of different platforms and protocols,and the impact of individual differences on expression signatures[16].Therefore, to better understand the events leading to PE,it is necessary to

*Corresponding author.

E-mail address:juntao_liu@https://www.360docs.net/doc/fe7107863.html,(J.

Liu).Contents lists available at ScienceDirect

Placenta

journal homepage:www.elsev https://www.360docs.net/doc/fe7107863.html,/locat e/placen

ta

0143-4004/$e see front matteró2013Elsevier Ltd.All rights reserved.

https://www.360docs.net/doc/fe7107863.html,/10.1016/j.placenta.2013.09.013

Placenta34(2013)1190e1195

continue the search for genes involved in the pathophysiology of the disease.

The Connectivity Map(CMAP)is a collection of genome-wide transcriptional expression data collected from cultured human cells treated with bioactive small molecules.Its purpose is to identify associations between gene expression pro?les due to the disease state and drug treatment state.The biological connection between disease and drug treatment states can be established by comparing the genome-wide expression pro?ling of the two states. Despite the fact that CAMP was established on cultured cell lines due to the ease of such an operation,wherein DEGs were identi?ed by comparing the microarray hybridization signal between drug-treated cell lines and controls,CAMP was also found to be an ef?-cacious method to query the DEGs originating from disease tissues vs.control tissues.It is believed that the strategy of using ratio values can diminish any sample differences.For example,if the gene-expression signature of a small molecular compound is found to be the opposite of that characterizing a disease state,then the compound might be used as a drug to treat that disease.CMAP has previously been used to discover mechanisms of drug action and disease pathogenesis,as well as to identify new potential thera-peutics[19e22].

To explore novel genes involved in the development of PE in the Chinese Han population,as well as to seek potential therapeutic agents for PE,we generated a global gene expression pro?le via DNA oligonucleotide microarrays for placental tissues from PE and control pregnancy tissues.Moreover,the resultant PE gene expression signature was used in silico by employing CMAP analysis to identify therapeutic agents that could potentially be effective against this disease.

2.Materials and methods

2.1.Patient clinical de?nitions

This case-control study was approved by the local ethics committee.Placental samples were collected from women whose pregnancies were complicated by se-vere preeclampsia(n?5)and from women without PE(n?5)at Peking Union Medical College Hospital.Given that gene expression in placental tissues may be in?uenced by gestational age and uterine contractions,we chose5preterm controls complicated with premature rupture of membranes(PROM).All?ve control cases were in good condition before PROM.After fetal lung maturating,C-sections were performed due to malpresentation(n?4)and previous C-section(n?1).None of the mothers were in https://www.360docs.net/doc/fe7107863.html,plete blood count and C-reactive protein monitoring showed no signs of infection prior to C-section.Bacterial cultures of uterine cavity swabs during operation were negative.Severe preeclampsia was de?ned as blood pressure!160/100mmHg,measured at least6h apart,in combination with pro-teinuria!3g/24h or!2t(dipstick),developing after20weeks of pregnancy. Women who had a history of cardiovascular,renal,and other hypertension-associated diseases were excluded;however,family history of PE was not recor-ded.C-sections were performed in all preeclampsia cases due to medical indications. All patients provided informed consent for the study.Patient data are summarized in Table1.2.2.Sample collection

Placental biopsies were obtained immediately after deliveries.Samples of approximately0.2e0.5cm3were excised from central cotyledons close to the um-bilical cord to reduce the possible bias due to regional differences in gene expres-sion.After extensive washing in saline solution to remove excess blood,the samples were stored in RNAlater reagent(Qiagen,Valencia,CA,USA).

2.3.RNA extraction from tissue samples

Total RNA was extracted from placental tissues using Trizol reagent(Life Tech-nologies,Gaithersburg,MD,USA).RNA quality was evaluated using formaldehyde agarose gel electrophoresis and was quanti?ed via spectrophotometry(NanoDrop, Wilmington,DE,USA).

2.4.Microarray analysis

RNA was ampli?ed and labeled according to a previous protocol.Brie?y,total RNA was used to synthesize the double stranded cDNA.RNA was ampli?ed by in vitro transcription using Ambion’s MessageAmp?II aRNA Ampli?cation Kits(Life Tech-nologies,Austin,TX,USA).Then,aRNA was reverse transcribed into cDNA and further labeled with Klenow enzyme.cDNA from PE placental tissue was labeled with Cy5-dCTP,and cDNA from control placental tissue was labeled with Cy3-dCTP. Fluorescent dye-labeled cDNA was hybridized to an Agilent SurePrint G3Human GE 8?60K Microarray(Agilent Technologies,Santa Clara,CA,USA).Hybridization, scanning and washing were performed on Agilent’s Microarray Platform according to Agilent’s standard protocols.The array data were analyzed with Agilent Feature Extraction software.Although the dual-color microarray method was adopted here, which can save microarray slides,we extracted the single channel intensity instead of the ratio value from each dual-color slide for DEGs analysis.The strategy to extract hybridization signals from dual-color microarray for DEGs analysis has been re-ported in a few previous studies[23,24].

After global mean normalization,probes with an intensity<400were?ltered out for further analysis.SAM(Signi?cance analysis of microarrays)software[25]was used to identify DEGs with a threshold set at a fold change>2and a q value<0.05. DEGs were further analyzed with function enrichment of the GO terms using R language package software.

2.5.Validation of differentially expressed genes

To validate the results of the microarray,ten DEGs involved in oxidative stress were selected for analysis by quantitative real-time PCR(qRT-PCR).Total RNA used in the microarray analysis was treated with DNase,and1m g of DNase-treated RNA was reverse transcribed to cDNA with oligo(dT)15using M-MLV reverse tran-scriptase(Life Technologies)in a total volume of20m L.After the reverse tran-scription reaction,1m L of the reaction mixture was used for a qPCR program of45 cycles consisting of melting(30s at94 C),annealing(30s at58 C)and extension (30s at72 C).The20m L reaction mixture contained1?PCR Buffer(Mg2tPlus), 0.5m M forward primer0.5m M reverse primer,200m M of each dNTP,and Eva Green Master Mix in a LightCyclerò480Real-Time PCR System(Roche Applied Science). The primers in this assay were designed with the primer software version5.0and

Table1

Maternal and fetal clinical characteristics.

Characteristic Controls(n?5)Preeclampsia

patients(n?5)

P value

Maternal age,years30.6?3.626.6?5.40.208 Gestational age,weeks32.0?1.931.7?3.10.854 Prepregnancy body mass index22.6?2.124.2?3.20.760 Body mass index at delivery27.8?2.829.9?3.30.344 Systolic blood pressure,mmHg121?8168?11<0.001 Diastolic blood pressure,mmHg68?9113?6<0.001 24h Proteinuria(g)Not tested 6.5?3.2e Proteinuria(dipstick)Negativettt<0.001 Multipara22 1.000 Nullipara33 1.000 Fetal sex:male/female5/04/1 1.000 Infant birth weight(g)1886?5811482?7450.367 Small for gestational age030.167Table2

Primers used for quantitative real-time RT-PCR.

Gene symbol Sequences(50e30)Product sizes(bp)

FLT1F GTCAGTCCAAGAAGTGACACCG150

R GTTACACCACTGTCGGCCAA

LEP F CTGCTCTGGAAAATGTGACCC248

R CGCCATCTAGTGACCTTGTGAT

CXCL12F TCCAAATCCCCTAAGCAGACC177

R CCTTCTCCTGGACCATTTTCAC

SLC8A1F AAAGCTAGCCTAGAAGCACCAA163

R TGAAATCGACCAATGCAAGAA

TFRC F TGGTTCGGGTGTTACGCA181

R CAGGAATATTGAGCCTGTTAGCA

CYBB F CACTTAGGTCCAGCCTGTTCAC177

R TAGAAAGGGCCAATATTCTCAGA

SH3PXD2A F CCAGAATCAATGGTGGTGCTAA168

R CCAAAGAGTCCCGTCAAAGTG

CD36F AAACGGCTGCAGGTCAACC186

R CATTTCTATCAGGCCAAGGAGG

CYP11A1F TCAACCTCATTCTGATGCCTG161

R GGGACAGACGACTGAAGATGC

SEPP1F ACTGAAAGGTGATTGCAGCTTT151

R TCTTTGTTGTTCTTCCTCCATTC

b-actin F CCATCGTCCACCGCAAAT194

R GCTGTCACCTTCACCGTTC

F:forward primer;R:reverse primer.

Y.Song et al./Placenta34(2013)1190e11951191

were synthesized by Invitrogen (Invitrogen,Beijing,China),as shown in Table 2.Data were analyzed by the 2àDD Ct method.b -actin was used as a reference gene.All other results are shown as fold-change relative to the b -actin https://www.360docs.net/doc/fe7107863.html,parison of gene expression pro ?les with the CMAP database

The DEGs of PE and control placental tissues were used to query the CMAP database (build 02),which contains more than 7000expression pro ?les representing 1309compounds [26].The similarity between the gene expression pro ?le of the query signature and that of a CMAP instance is measured by the connectivity score,which ranges from à1to 1.A high positive connectivity score indicates that the corre-sponding drug induces the expression of the query signature.A high negative con-nectivity score indicates that the corresponding drug reverses the expression of the query signature.Prior to the query in the CMAP database via the Internet (https://www.360docs.net/doc/fe7107863.html,/cmap ),the probe ID of Agilent SurePrint G3Human GE 8?60K Microarray was transformed into the probe ID de ?ned by the AffymetrixGeneChip Human Genome U133A array according to the probe ’s corresponding gene.

3.Results 3.1.DEGs in PE

We compared the global gene expression pro ?les of placental tissues from the PEs and controls using oligonucleotide micro-arrays.The original microarray data were submitted to GEO with an accession number of GSE47187.After normalization,DEGs were assessed using one class analysis in the SAM software,with the signi ?cance threshold set to fold changes greater than 2.0and a q value less than 0.05.A total of 224transcripts were identi ?ed as

being signi ?cantly differentially expressed (a full list of DEGs is presented in the Supplementary Material ).The heat map of DEGs is shown in Fig.1.Of these DEGs,91genes were up-regulated,and 133genes were down-regulated in PE placentas compared to control placentas.Speci ?cally,LEPTIN,FLT1,CRH,INHBA,INHA,BCL6,and pappalysin 2were signi ?cantly up-regulated in the PE group,which is consistent with their previously described association with this disease.After function enrichment analysis,the top three signi ?-cantly functional group genes that explain the molecular mecha-nisms of PE were found to be involved in immune response,in ?ammatory response and chemotaxis.We also found that genes involved in oxidative stress were signi ?cantly changed.These genes are listed in Table 3.

3.2.Validation of DEGs using qRT-PCR

To further validate the microarray results,especially the func-tional genes involved in oxidative stress as identi ?ed by microarray,ten of the DEGs related to oxidative stress were chosen for further validation using quantitative RT-PCR.The ratio of the average expression levels of each gene between the PE placentas and control placental tissues was measured using the same batch of samples used in the microarray.As shown in Fig.2,fold changes measured by microarray were closely correlated with those measured by quanti-tative RT-PCR,which con ?rmed that large differences in gene expression are present between the PE and control https://www.360docs.net/doc/fe7107863.html,parison of gene expression pro ?les with the CMAP database

To better understand the pathogenesis of PE and to identify potential therapeutic agents,the DEGs were used to compare the expression signatures of 1309compounds in the CMAP

database.

Fig.1.Heat map of the 224genes that were signi ?cantly increased and decreased in ?ve preeclamptic placentas,as compared with ?ve control placentas (fold change >2and q <0.05in the SAM software).The red color indicates up-regulation and green indicates down-regulation.

Table 3

List of altered genes related with oxidative stresses.Gene symbol Fold change GO molecular function FLT1

8.6

GO:0001666(response to hypoxia);GO:0008284

(positive regulation of cell proliferation);GO:0045766(positive regulation of angiogenesis)

LEP 124.5

GO:0001666(response to hypoxia);GO:0001819

(positive regulation of cytokine production);GO:0008284(positive regulation of cell proliferation)

CXCL120.27

GO:0001666(response to hypoxia);GO:0006955

(immune response);GO:0006874(cellular calcium ion homeostasis);GO:0008284(positive regulation of cell proliferation)

SLC8A10.49

GO:0001666(response to hypoxia);GO:0006874(cellular calcium ion homeostasis);GO:0042542(response to hydrogen peroxide)

TFRC 0.39GO:0001666(response to hypoxia);GO:0010035(response to inorganic substance)

CYBB

0.36

GO:0006954(in ?ammatory response);GO:0006801(superoxide metabolic process);GO:0022900(electron transport chain)

SH3PXD2A 2.5GO:0006801(superoxide metabolic process);GO:0007154(cell communication)

CD36

0.46

GO:2000121(regulation of removal of superoxide radicals);GO:0007263(nitric oxide mediated signal transduction);GO:2000379(positive regulation of reactive oxygen species metabolic process)CYP11A1 2.7GO:0042542(response to hydrogen peroxide);GO:0042493(response to drug)

SLC8A1

0.49

GO:0001666(response to hypoxia);GO:0006874(cellular calcium ion homeostasis);GO:0042542(response to hydrogen peroxide)

SEPP10.34

GO:0006979(response to oxidative stress)

GO:gene ontology.

Y.Song et al./Placenta 34(2013)1190e 1195

1192

The similarity of the gene expression pro ?le between the query signature and that of a CMAP instance was measured by the con-nectivity score,which ranges from à1to 1.A connection score of c ?1signi ?es that the gene signature has the maximum positive connection strength with the reference pro ?le,which indicates that the experimental condition that gives rise to this gene signature had the strongest possible correlation with the reference pro ?le.A connection score of c ?à1indicates that the two experimental permutations were most inversely correlated.Because we intended to screen drugs that can reverse the disease status,we identi ?ed ?ve compounds,cinchonine,hesperidin,probenecid,nifuroxazide and primidone,with an average connectivity scores less than à0.7(listed in Table 4),indicating their potential molecular signatures that may counteract that of PE.4.Discussion

The present study represents a comprehensive analysis of the expression pro ?les of placental tissues from ?ve patients with PE and ?ve healthy controls,and the ?ndings provide further valida-tion of signi ?cant DEGs using quantitative real-time RT-PCR.We identi ?ed 91genes that were up-regulated and 131genes that were down-regulated in PE placentas,compared to control placentas.GO enrichment analysis revealed that these genes were involved in regulating the immune response,in ?ammatory response,chemo-taxis,and hypoxia response,among other actions.These ?ndings not only add to a growing body of literature demonstrating dys-regulated genes and biological pathways in PE pregnancies,but it also provides the basis for the identi ?cation of new biomarkers in PE that are worthy of future in-depth studies to elucidate their roles in PE.

Microarray technology has been widely used for identifying genes responsible for PE.These studies identi ?ed many genes associated with PE;however,the results of the different studies have shown varying degrees of overlap,which highlights the heterogeneity of PE.Potential explanations for the discrepancies include differences in maternal ethnicities,as well as variations in platforms and protocols [16].In addition,the placental sam-ples from the previous studies are mainly derived from Caucasian subjects [27].As the rates of PE are lower among Asian women compared to Caucasian women,it would be worth repeating the expression pro ?le analysis with placentas from Chinese women.As expected,our studies identi ?ed many of the same genes as highlighted by previous studies,such as LEPTIN,FLT1,CRH,INHBA,INHA,BCL6,and pappalysin 2.However,the CXCL12and CXCL9

genes that were reported previously to be up-regulated in PE [28,29]were identi ?ed as down-regulated genes in our present analysis.This discrepancy may be due to the complexity of the placenta.The placental samples consisted mainly of trophoblasts,as well as blood vessels,macrophages and ?broblasts.The dif-ferences in CXCL12expression between the present study and other experiments may re ?ect the different tissue components involved.In addition,the DEGs in PE placentas,which are known to be affected by oxidative stress,were also identi ?ed.These genes included SLC8A1,TFRC,CYBB,SH3PXD2A,CD36,CYP11A1,and SEPP1.Our results are consistent with previous studies and may highlight an important role for oxidative stress in the pathogenesis of PE [30].

The pathogenesis of PE,which represents a serious pregnancy complication,is not fully understood;however,it is obvious that oxidative stress and in ?ammation are important mechanisms in the development of this disease [6].Therefore,antioxidant sup-plementation or anti-in ?ammatory agents may be potential treatments for prevention or amelioration of PE.One small trial has evaluated high doses of vitamins C and E as anti-oxidant agents for prevention of PE [31].Unfortunately,the bene ?ts of these treatments were not con ?rmed in several subsequent studies [32,33].Therefore,new methods of preventing PE are still needed.

Increased uric acid level is also a key clinical feature of PE.Higher levels of uric acid are positively correlated with signi ?cant maternal and fetal morbidity and mortality [34,35].Because high levels of uric acid can promote in ?ammation,oxidative stress and endothelial dysfunction,the hypothesis that hyperuricemia con-tributes to vascular damage in PE is generally accepted [34],despite the fact that its speci ?c role in the pathogenesis of PE remains unclear.

In this study,we employed CMAP analysis to identify potential therapeutic agents for PE.These agents would reverse the gene expression signature of PE placental tissue to control levels.The top ?ve compounds that demonstrated opposite correlations with DEGs in PE vs.control placentas include cinchonine,hesper-idin,probenecid,nifuroxazide and primidone.Hesperidin is one

of

https://www.360docs.net/doc/fe7107863.html,parison of gene expression changes obtained with microarray and quan-titative real time RT-PCR.

Table 4

The top ?ve agents showing highly negative correlations with PE in the CMAP database.Rank Agent P value a Score

Speci ?city b Function

1Cinchonine 0.00034à0.8890.0062It has been used for treatment of malaria 2

Hesperidin

0.00064à0.8630

It acts as an antioxidant and also can reduced cholesterol and blood pressure

3Probenecid 0.00131à0.8350

It increases uric acid excretion in the urine and was primarily used in treating gout and hyperuricemia.

4Nifuroxazide 0.00328à0.7980.0213It was used to treat colitis and diarrhea 5

Primidone

0.00559à0.7710

It is a mainstay anticonvulsant in

the treatment of partial and generalized seizures

a

The two tailed p value was calculated between a random gene signature and the speci ?c gene signature in CMAP database,which indicated the proportion of random connection scores that are greater than the observed score [45].b

Speci ?city is an estimate of the uniqueness of the connectivity between the interrogated gene signature and a speci ?c gene signature in CMAP.High speci ?city scores indicate that the extent of connectivity found between the interrogated in-stances and the interested signature in CMAP is unexceptional and/or the investi-gated agents have multiple biological effects.

Y.Song et al./Placenta 34(2013)1190e 11951193

the most abundant natural?avonoids[36]and has anti-in?ammatory and analgesic activities[37].Some reports indicate that hesperidin could also prevent oxidant injury by several mechanisms,such as scavenging for oxygen radicals,protecting against lipid peroxidation and chelating metal ions[38].Currently, it remains unclear whether vitamins C and E can prevent PE.One matter of debate is the optimal antioxidant dose.For daily sup-plements,40mg/day,45mg/day and60e95mg/day vitamin C are recommended by UK Food Standards Agency,World Health Orga-nization and US National Academy of Science,respectively.How-ever,some studies demonstrated that the lower doses of vitamin C were not con?rmed as effective antioxidants,whereas the higher doses are effective.Levine and colleagues reported an improve-ment in endothelium-dependent vasodilation after administration of2000mg/day ascorbic acid[39],but kinetic studies show that plasma saturation occurs at1000mg/day[40].Polidori and col-leagues also reported that plasma and body saturation with 1000mg/day vitamin C in humans appears desirable to maximize antioxidant protection and lower risk of oxidative damage[41]. These?ndings suggest that the sole intake of a higher dose of vitamin C above1000mg/day does not increase the ascorbic acid concentration in plasma.Interestingly,a previous study has shown that certain?avonoids increase the biological value of ascorbic acid [42].Another study also showed that a daily supplement consisting of a commercial bio?avonoid mixture,at a dose of200mg three times a day for a month,resulted in a signi?cant increase in the ratio of reduced to oxidized ascorbic acid in pregnant women compared to controls,who received lactose placebo capsules[43]. One potential explanation for this?nding is that?avonoids can increase ascorbic acid storage.A second explanation is that?avo-noids may reduce the absorption of heavy metal ions or increase the levels of reduced glutathione.Therefore,it is interesting to consider the possibility that a combination of vitamin C and?a-vonoids can increase the biological value of vitamin C in PE clinical management.

CMAP analysis also indicated that probenecid showed an opposite correlation with DEGs in PE vs.control tissues.Probenecid restrains the active reabsorption of urate in the renal tubular,in-creases the excretion of urate,and reduces the concentration of urate in the blood.Thus,probenecid can promote the excretion of uric acid and reduce the deposition of uric acid in serum[44].The CMAP analysis found that the two compounds that are most effective in reversing the PE phenotype were also related to in?ammation,oxidation or hyperuricemia.These data indirectly imply that genes involved in oxidative stress and in?ammation also play an important role in PE pathophysiology.However,given the design principles of CMAP,potential compounds were identi?ed based on similarity comparisons of gene expression signatures. Therefore,the method is,so far,unable to identify genes that are key-points of pathogenesis or therapeutic targets.

In conclusion,we identi?ed a DEGs signature in PE using Chinese Han placental tissues.These observations con?rm and expand upon the current knowledge of the pathophysiology of PE and may provide the basis for developing novel diagnostic bio-markers of PE to improve reproductive outcomes.We also used the CMAP to identify compounds with molecular signatures that can counteract those of PE.The expression pro?ling,combined with the CMAP analysis,suggest possible therapeutic agents for clinical trials to develop novel prevention strategies and treat-ments for PE.

Acknowledgments

This study was supported by the National Nature Science Foundation of China(81100446).Appendix A.Supplementary data

Supplementary data related to this article can be found at http:// https://www.360docs.net/doc/fe7107863.html,/10.1016/j.placenta.2013.09.013.

References

[1]Steegers EA,von Dadelszen P,Duvekot JJ,Pijnenborg https://www.360docs.net/doc/fe7107863.html,ncet

2010;376(9741):631e44.

[2]Huppertz B.Placental origins of preeclampsia:challenging the current hy-

pothesis.Hypertension2008;51(4):970e5.

[3]Roberts JM,Cooper DW.Pathogenesis and genetics of https://www.360docs.net/doc/fe7107863.html,ncet

2001;357(9249):53e6.

[4]Sun CJ,Zhang L,Zhang WY.Gene expression pro?ling of maternal blood in

early onset severe preeclampsia:identi?cation of novel biomarkers.J Perinat Med2009;37(6):609e16.

[5]James JL,Whitley GS,Cartwright JE.Pre-eclampsia:?tting together the

placental,immune and cardiovascular pieces.J Pathol2010;221(4):363e78.

[6]Young BC,Levine RJ,Karumanchi SA.Pathogenesis of preeclampsia.Ann Rev

Pathol2010;5:173e92.

[7]Kajii T,Ohama K.Androgenetic origin of hydatidiform mole.Nature

1977;268(5621):633e4.

[8]Salonen Ros H,Lichtenstein P,Lipworth L,Cnattingius S.Genetic effects on the

liability of developing pre-eclampsia and gestational hypertension.Am J Med Genet2000;91(4):256e60.

[9]Moses EK,Fitzpatrick E,Freed KA,Dyer TD,Forrest S,Elliott K,et al.Objective

prioritization of positional candidate genes at a quantitative trait locus for pre-eclampsia on2q22.Mol Hum Reprod2006;12(8):505e12.

[10]Schadt EE,Zhang B,Zhu J.Advances in systems biology are enhancing our

understanding of disease and moving us closer to novel disease treatments.

Genetica2009;136(2):259e69.

[11]Centlow M,Wingren C,Borrebaeck C,Brownstein MJ,Hansson SR.Differential

gene expression analysis of placentas with increased vascular resistance and pre-eclampsia using whole-genome microarrays.J Pregnancy2011;2011: 472354.

[12]Han JY,Kim YS,Cho GJ,Roh GS,Kim HJ,Choi WJ,et al.Altered gene expression

of caspase-10,death receptor-3and IGFBP-3in preeclamptic placentas.Mol Cells2006;22(2):168e74.

[13]Gack S,Marme A,Marme F,Wrobel G,Vonderstrass B,Bastert G,et al.Pre-

eclampsia:increased expression of soluble ADAM12.J Mol Med(Berl) 2005;83(11):887e96.

[14]Heikkila A,Tuomisto T,Hakkinen SK,Keski-Nisula L,Heinonen S,Yla-

Herttuala S.Tumor suppressor and growth regulatory genes are overex-pressed in severe early-onset preeclampsia e an array study on case-speci?c human preeclamptic placental tissue.Acta Obstet Gynecol Scand 2005;84(7):679e89.

[15]Herse F,Dechend R,Harsem NK,Wallukat G,Janke J,Qadri F,et al.Dysre-

gulation of the circulating and tissue-based renin-angiotensin system in preeclampsia.Hypertension2007;49(3):604e11.

[16]Kang JH,Song H,Yoon JA,Park DY,Kim SH,Lee KJ,et al.Preeclampsia leads to

dysregulation of various signaling pathways in placenta.J Hypertens 2011;29(5):928e36.

[17]Nishizawa H,Ota S,Suzuki M,Kato T,Sekiya T,Kurahashi H,et https://www.360docs.net/doc/fe7107863.html,parative

gene expression pro?ling of placentas from patients with severe pre-eclampsia and unexplained fetal growth restriction.Reprod Biol Endocrinol 2011;9:107.

[18]Meng T,Chen H,Sun M,Wang H,Zhao G,Wang X.Identi?cation of differential

gene expression pro?les in placentas from preeclamptic pregnancies versus normal pregnancies by DNA microarrays.OMICS2012;16(6):301e11. [19]Fayad W,Fryknas M,Brnjic S,Olofsson MH,Larsson R,Linder S.Identi?cation

of a novel topoisomerase inhibitor effective in cells overexpressing drug ef?ux transporters.PLoS One2009;4(10):e7238.

[20]Gheeya J,Johansson P,Chen QR,Dexheimer T,Metaferia B,Song YK,et al.

Expression pro?ling identi?es epoxy anthraquinone derivative as a DNA topoisomerase inhibitor.Cancer Lett2010;293(1):124e31.

[21]Hieronymus H,Lamb J,Ross KN,Peng XP,Clement C,Rodina A,et al.Gene

expression signature-based chemical genomic prediction identi?es a novel class of HSP90pathway modulators.Cancer Cell2006;10(4):321e30.

[22]Slonim DK,Koide K,Johnson KL,Tantravahi U,Cowan JM,Jarrah Z,et al.

Functional genomic analysis of amniotic?uid cell-free mRNA suggests that oxidative stress is signi?cant in Down syndrome fetuses.Proc Natl Acad Sci U S A2009;106(23):9425e9.

[23]t Hoen PA,Turk R,Boer JM,Sterrenburg E,de Menezes RX,van Ommen GJ,

et al.Intensity-based analysis of two-colour microarrays enables ef?cient and ?exible hybridization designs.Nucleic Acids Res2004;32(4):e41.

[24]Xia Q,Cheng D,Duan J,Wang G,Cheng T,Zha X,et al.Microarray-based gene

expression pro?les in multiple tissues of the domesticated silkworm,Bombyx mori.Genome Biol2007;8(8):R162.

[25]Tusher VG,Tibshirani R,Chu G.Signi?cance analysis of microarrays applied to

the ionizing radiation response.Proc Natl Acad Sci U S A2001;98(9):5116e21.

[26]Lamb J,Crawford ED,Peck D,Modell JW,Blat IC,Wrobel MJ,et al.The con-

nectivity map:using gene-expression signatures to connect small molecules, genes,and disease.Science2006;313(5795):1929e35.

Y.Song et al./Placenta34(2013)1190e1195 1194

[27]Hansson SR,Chen Y,Brodszki J,Chen M,Hernandez-Andrade E,Inman JM,

et al.Gene expression pro?ling of human placentas from preeclamptic and normotensive pregnancies.Mol Hum Reprod2006;12(3):169e79.

[28]Hwang HS,Kwon HS,Sohn IS,Park YW,Kim YH.Increased CXCL12expression

in the placentae of women with pre-eclampsia.Eur J Obstet Gynecol Reprod Biol2012;160(2):137e41.

[29]Schanz A,Winn VD,Fisher SJ,Blumenstein M,Heiss C,Hess AP,et al.Pre-

eclampsia is associated with elevated CXCL12levels in placental syncytio-trophoblasts and maternal blood.Eur J Obstet Gynecol Reprod Biol 2011;157(1):32e7.

[30]Siddiqui IA,Jaleel A,Tamimi W,Al Kadri HM.Role of oxidative stress in the

pathogenesis of preeclampsia.Arch Gynecol Obstet2010;282(5):469e74. [31]Chappell LC,Seed PT,Briley AL,Kelly FJ,Lee R,Hunt BJ,et al.Effect of anti-

oxidants on the occurrence of pre-eclampsia in women at increased risk:a randomised https://www.360docs.net/doc/fe7107863.html,ncet1999;354(9181):810e6.

[32]Poston L,Briley AL,Seed PT,Kelly FJ,Shennan AH.Vitamin C and vitamin E in

pregnant women at risk for pre-eclampsia(VIP trial):randomised placebo-controlled https://www.360docs.net/doc/fe7107863.html,ncet2006;367(9517):1145e54.

[33]Rumbold AR,Crowther CA,Haslam RR,Dekker GA,Robinson JS.Vitamins C

and E and the risks of preeclampsia and perinatal complications.N Engl J Med 2006;354(17):1796e806.

[34]Bainbridge SA,Roberts JM.Uric acid as a pathogenic factor in preeclampsia.

Placenta2008;29(Suppl.A):S67e72.

[35]Culleton BF,Larson MG,Kannel WB,Levy D.Serum uric acid and risk for

cardiovascular disease and death:the Framingham Heart Study.Ann Intern Med1999;131(1):7e13.[36]Garg A,Garg S,Zaneveld LJ,Singla AK.Chemistry and pharmacology of the

Citrus bio?avonoid hesperidin.Phytother Res2001;15(8):655e69.

[37]Galati EM,Monforte MT,Kirjavainen S,Forestieri AM,Trovato A,Tripodo MM.

Biological effects of hesperidin,a citrus?avonoid.(Note I):antiin?ammatory and analgesic activity.Farmaco1994;40(11):709e12.

[38]Kalpana KB,Srinivasan M,Menon VP.Evaluation of antioxidant activity of hes-

peridin and its protective effect on H2O2induced oxidative damage on pBR322 DNA and RBC cellular membrane.Mol Cell Biochem2009;323(1e2):21e9. [39]Levine GN,Frei B,Koulouris SN,Gerhard MD,Keaney Jr JF,Vita JA.Ascorbic

acid reverses endothelial vasomotor dysfunction in patients with coronary artery disease.Circulation1996;93(6):1107e13.

[40]Levine M,Conry-Cantilena C,Wang Y,Welch RW,Washko PW,Dhariwal KR,

et al.Vitamin C pharmacokinetics in healthy volunteers:evidence for a rec-ommended dietary allowance.Proc Natl Acad Sci U S A1996;93(8):3704e9.

[41]Polidori MC,Mecocci P,Levine M,Frei B.Short-term and long-term vitamin C

supplementation in humans dose-dependently increases the resistance of plasma to ex vivo lipid peroxidation.Arch Biochem Biophys2004;423(1):109e15. [42]Clark WG,Mac KE.The absorption and excretion of rutin and related?avonoid

substances.J Am Med Assoc1950;143(16):1411e5.

[43]Clemetson CA,Andersen L.Plant polyphenols as antioxidants for ascorbic acid.

Ann N Y Acad Sci1966;136(14):341e76.

[44]Jain AK,Ryan JR,McMahon https://www.360docs.net/doc/fe7107863.html,parison of ticrynafen and probenecid in

patients with elevated uric acid levels.Nephron1979;23(Suppl.1):46e50. [45]Zhang SD,Gant TW.A simple and robust method for connecting small-

molecule drugs using gene-expression signatures.BMC Bioinformatics 2008;9:258.

Y.Song et al./Placenta34(2013)1190e11951195